ElDemocrata

España en español es para cualquier persona que viva en España, visite España o cualquier persona interesada en las últimas noticias, eventos y deportes en España. Descubra más ahora.

Virus de la viruela del simio en muestras de aguas residuales del Área Metropolitana de Santiago, Chile – Volumen 29, Número 11 – Noviembre 2023 – Journal of Emerging Infectious Diseases

Virus de la viruela del simio en muestras de aguas residuales del Área Metropolitana de Santiago, Chile – Volumen 29, Número 11 – Noviembre 2023 – Journal of Emerging Infectious Diseases


Afiliaciones de autor: Universidad de Chile, Santiago, Chile (M. Ampuero, R. Soto Rivo, A. Jajero); Pontificia Universidad Católica de Chile, Santiago (C. Martínez-Valdebenito, M. Ferrés); Instituto Milenio de Inmunología e Inmunoterapia, Santiago (Revista R. Soto)

El 13 de mayo de 2022, la Organización Mundial de la Salud lanzó una alerta provocada por un aumento significativo del número de infecciones por el virus de la viruela simica (MPXV), causante de la viruela, una enfermedad zoonótica endémica en algunos países de África central y occidental que se ha extendido rápidamente a países no endémicos (1). El 17 de julio se confirmó un caso de MPXV en Chile y desde entonces se han reportado más de 1.400 casos y dos muertes relacionadas con el virus de la viruela durante el brote, según el Ministerio de Salud de Chile (2). El Área Metropolitana de Santiago de Chile es la zona más poblada del país, representa más del 40% de la población total y la mayoría (81%) de los casos de MPXV reportados (2).

Se ha demostrado que el monitoreo de aguas residuales contribuye de manera importante a la vigilancia de virus, como el poliovirus y el SARS-CoV-2, permitiendo el seguimiento de nuevas variantes, proporcionando así una visión precisa de la infección a nivel de población (35). En este sentido, la detección de MPXV en muestras de aguas residuales también se ha propuesto como un complemento útil a la vigilancia clínica (69). Debido a que el estigma y la discriminación asociados con algunas infecciones limitan la disposición de las personas en riesgo a consultar los centros hospitalarios, la epidemiología basada en aguas residuales (WBE) se vuelve más útil porque las muestras agrupadas anónimas permiten visualizar las contribuciones de la comunidad sin revelar identidades individuales.10).

Reportamos el monitoreo de ADN de MPXV en aguas residuales en muestras de aguas residuales de 3 plantas de tratamiento de aguas residuales (PTAR), que representan el 85% del total de aguas residuales del Área Metropolitana de Santiago, representativas >5,5 millones de personas. También informamos la presencia del virus MPXV infeccioso en esas muestras.

Recolectamos 21 muestras de aguas residuales crudas de abril a septiembre de 2022 de las plantas de tratamiento de aguas residuales El Tribal (n = 6), La Farfana (n = 6) y La Higuera (n = 9). Las muestras se recolectaron en viales estériles de propileno de 1000 ml, las transportaron al Laboratorio de Virología Ambiental de la Facultad de Medicina de la Universidad de Chile y las almacenaron a 4°C hasta su procesamiento.

READ  Webinar sobre viruela símica y reuniones masivas - OPS/OMS

Concentramos las muestras mediante ultracentrifugación según el protocolo descrito por Fumian et al. (11). Resuspendimos el sedimento obtenido en 200 μl de solución salina tamponada con fosfato y lo almacenamos a -80 ° C hasta su uso.

Utilizamos 200 μl de partículas virales concentradas para aislar el ADN utilizando el QIAamp DNA MiniKit (QIAGEN, https://www.qiagen.com), según las instrucciones proporcionadas por el proveedor. Mezclamos 5 μl de ADN con un dispositivo de detección de microbios TaqMan MonkeyPox Vi07922155_s1 (ThermoFisher Scientific, https://www.thermofisher.com) y TaqPath 1-Step Multiplex Master Mix (ThermoFisher Scientific) para la detección específica de ADN de MPXV en una máquina de PCR en tiempo real QuantStudio 5 (ThermoFisher Scientific). El plásmido pMG-Amp que lleva el fragmento sintético de ADN de MPXV 5′-GTGTCTGAATCGTTCGATTAACCCAACTCATCCATTTTCAGATGAATAGAGTTATCGATTCAGACACATGCTTTGAGTTTTGTTGAATCGATGAGTGAAGTATCATCGTTGCACCTTCAGATGC-3′, que contiene la secuencia objetivo de los cebadores, se sintetizó en Macrogen Inc.https://www.macrogen.com). Utilizamos este plásmido como control positivo y como plantilla para una curva de calibración que permite la cuantificación de copias del genoma de MPXV por mililitro. Clonamos el fragmento de ADN amplificado en pGEM-T Easy Vector (Promega, https://www.promega.com) y convertirlo a Escherichia coli JM109. Se secuenciaron cinco copias de cada muestra en Macrogen Inc. y en comparación con secuencias de MPXV del brote de 2022.

Entre 21 muestras de aguas residuales recolectadas y analizadas de las tres plantas de tratamiento de aguas residuales, detectamos ADN de MPXV en 6 (Tabla). De acuerdo con los casos de viruela reportados anteriormente en Chile, se detectó ADN viral en muestras de aguas residuales recolectadas en julio (La Farfana), agosto (La Farfana, El Tribal) y septiembre (La Farfana, El Tribal, La Higuera), pero no en abril o Mayo (tabla).

Figura 1

Figura 1. Comparación de secuencias de nucleótidos del amplicón MPXV obtenidas para muestras de aguas residuales del Área Metropolitana de Santiago, Chile (muestras de aguas residuales 1-9), con secuencias de referencia obtenidas de otros países durante 2022…

La cuantificación del ADN del MPXV en aguas residuales mostró cargas virales que oscilaban entre 35 y 2231 copias del genoma/ml (Tabla). Las altas cargas virales en muestras de aguas residuales se asociaron con un aumento en el número de casos reportados por el Ministerio de Salud de Chile en Santiago. La secuenciación de un fragmento de ADN amplificado de 106 pb procedente de muestras de aguas residuales mostró una homología del 100 % con la secuencia del virus MPXV del brote de 2022 notificado en Alemania, los Países Bajos, Italia, Francia, el Reino Unido, los Estados Unidos y Chile (Figura 1). .

Para determinar si las muestras de aguas residuales contenían virus MPXV viable, utilizamos las muestras con la carga viral más alta para inocular monocapas VeroE6 (ATCC CRL-1586). En este procedimiento, infectamos células con una mezcla de muestras de aguas residuales positivas para ADN de MPXV y medio de cultivo y recolectamos el sobrenadante después de 7 días para la detección por PCR. Almacenamos el sobrenadante restante y realizamos una segunda ronda de infección utilizando el sobrenadante de la primera infección. Utilizamos controles positivos y negativos en placas separadas para evitar la contaminación cruzada. A las 24 y 48 h postinfección, recogimos el sobrenadante para detectar MPXVDNA mediante PCR.

Además, inoculamos 300 μl de la muestra AF0922 suplementada con 700 μl de medio Eagle modificado por Dulbecco más suero bovino fetal (FBS) al 2% en células VeroE6 en una placa de 6 cm. Después de 2 h de incubación, reemplazamos el medio con 5 ml de medio Eagle modificado por Dulbecco más FBS al 2%. Después de 7 días, fijamos las células infectadas con glutaraldehído al 4% y realizamos una tinción negativa para su observación mediante microscopía electrónica (Figura complementaria). Todos los procedimientos relacionados con el aislamiento viral se realizaron en el laboratorio de nivel de bioseguridad 3 de la Unidad de Virología Aplicada de la Pontificia Universidad Católica de Chile, Santiago.

Figura 2

Detección del genoma viral del virus de la viruela simica en muestras de aguas residuales de plantas de tratamiento de aguas residuales del Área Metropolitana de Santiago, Chile.  A) Resultados de la PCR para sobrenadantes de células Vero E6 a 7 ppp.  B) Resultados de la PCR para muestras de sobrenadante de células Vero E6 infectadas con control positivo (sobrenadante de cultivo celular infectado por el virus de la viruela del mono) y controles negativos (medio Eagle modificado de Dulbecco más suero bovino fetal al 2 % y muestras negativas de aguas residuales).  ppp, días después de la infección.

Figura 2. Detección del genoma viral del virus de la viruela simica en muestras de aguas residuales de plantas de tratamiento de aguas residuales del Área Metropolitana de Santiago, Chile. A) Resultados de la PCR del sobrenadante de células Vero E6 a 7 ppp….

Detectamos una alta carga de ADN viral en el sobrenadante el día 7 después de la inoculación, lo que indica la presencia del virus MPXV infeccioso en las muestras de aguas residuales (Figura 2, panel A). No pudimos detectar el ADN de MPXV en células inoculadas con muestras que dieron negativo para el virus (Figura 2, panel B). Los análisis de microscopía electrónica de células VeroE6 inoculadas con MPXV recuperadas de la muestra AF0922 mostraron partículas virales intracelulares con un tamaño promedio de ≈300 nm (Figura complementaria).

WBE ha adquirido un papel cada vez más útil en los sistemas de vigilancia que detectan eficientemente microorganismos patógenos. También será útil como herramienta para el control y prevención oportunos de enfermedades infecciosas endémicas y emergentes.

READ  ¿Por qué la temporada de gripe comenzó tan temprano este año?

El uso de WBE como complemento a la vigilancia clínica integral permite determinar la circulación real de patógenos y su carga en la población. Por ejemplo, WBE se ha convertido en una herramienta útil en todo el mundo para visualizar la propagación del SARS-CoV-2 y sus variantes (35). Por lo tanto, WBE también puede complementar la vigilancia clínica de MPXV, permitiendo estimar la prevalencia real y el transporte del virus en la comunidad (6,9). Sin embargo, sería útil generar más información respecto a la eliminación del virus en la persona infectada; Carga de ADN viral en heces, orina, semen, saliva y otras secreciones. La persistencia e infectividad del virus en el medio ambiente, especialmente en un entorno complejo como las aguas residuales.

En conclusión, detectamos ADN de MPXV y determinamos su concentración en aguas residuales de Santiago, Chile. También pudimos aislar el virus de muestras con cargas virales más altas. Aunque la detección de virus viables en muestras de aguas residuales observadas en este estudio genera alarma, no hay información sobre los riesgos que esto puede representar para los empleados que trabajan en plantas de tratamiento. El riesgo potencial de transmisión ambiental del MPXV sigue siendo desconocido y, por tanto, sigue siendo un grave problema de salud pública.

El Sr. Ampuero es científico investigador del Laboratorio de Virología Ambiental de la Universidad de Chile, Santiago, Chile. Sus principales intereses de investigación son la identificación y caracterización de virus en aguas residuales.

cumbre

Agradecemos a Aguas Andinas, al personal de la planta de tratamiento de aguas residuales, al personal de la planta de tratamiento de aguas residuales de Sacyr y a Análisis Ambientales (https://www.anam.com) Los operadores proporcionan muestras de aguas residuales.

Este estudio contó con el apoyo de la Agencia Nacional de Investigación y Tecnología a través del Programa Fondecyt No. 1181656; Anillo otorga ATE220007 y ATE220016 a AG; Programa Fondecyt nro. 1230102; Anillo otorga ATE220016, ANID-ICM e ICN2021_045 a RS-R; Anello Beca ATE220061; Y el programa Fondecyt no. 1211825 a MF

AG participó en el diseño del estudio; MA y CM-V. experimentos realizados; AG, RS-R y MF analizaron los datos; AG, RS-R y CM-V. Él escribió el manuscrito. Todos los autores aprobaron la versión final del manuscrito.